View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21069_low_6 (Length: 229)
Name: NF21069_low_6
Description: NF21069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21069_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 42292804 - 42292882
Alignment:
| Q |
1 |
caatggaaggtttgctctataatgcacttgttgatgtcgtttttacagggcatgttcatgcctacgaacgctttgtaag |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42292804 |
caatggaaggtttgctctataatgcacttgttgatgtcgtttttacagggcatgttcatgcatacgaacgctttgtaag |
42292882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 166 - 198
Target Start/End: Original strand, 42292911 - 42292943
Alignment:
| Q |
166 |
tctagttgaagtactggttcaatcgggttgaaa |
198 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
42292911 |
tctagttgaagtgctggttcaatcgggttgaaa |
42292943 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University