View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21069_low_7 (Length: 213)
Name: NF21069_low_7
Description: NF21069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21069_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 46 - 201
Target Start/End: Original strand, 53419434 - 53419589
Alignment:
| Q |
46 |
caccatcgtggttcaacattgccatcaatgaatgtgaacccaaaacatgttggttgtcgtgaagacaaatatttccaatcatcatgttggttgttaaatc |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53419434 |
caccatcgtggttcaacattgccatcaatgaatgtgaacccaaaacatgttggttgtcgtgaagacaaatatttccaatcatcatgttggttgttaaatc |
53419533 |
T |
 |
| Q |
146 |
ctgcttccatcgaaatctctctcaattcttttctctgttcagttcataatattctt |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53419534 |
ctgcttccatcgaaatctctctcaattcttttctctgttcagttcataatattctt |
53419589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University