View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2106_high_7 (Length: 218)
Name: NF2106_high_7
Description: NF2106
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2106_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 15 - 196
Target Start/End: Complemental strand, 1266243 - 1266062
Alignment:
| Q |
15 |
gagaagaaaatgaggaagaaggcgaccaacaatgtcatggcttatagttttcatgtcttgtgaggttgatttggaaacaagggaagccatgtcgaggatg |
114 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1266243 |
gagaagaaaatgaggaagaaggcgaccgacaatgtcatggcttatagttttcatgtcttgtgaggttgatttggaaacaagggaagccatgtcgaggatg |
1266144 |
T |
 |
| Q |
115 |
ttcccggtgaagaagctaggtctcgggccccgaacaccttgcatctccatgattttcttgatgcgtagtggagtgaggaagt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1266143 |
ttcccggtgaagaagctaggtctcgggccccgaacaccttgcatctccatgattttcttgatgcgcagtggagtgaggaagt |
1266062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University