View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21070_high_24 (Length: 235)
Name: NF21070_high_24
Description: NF21070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21070_high_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 3652314 - 3652533
Alignment:
| Q |
1 |
cataacacaaacacaattgtatatatattttgattcttgattaactattaatcaacattatttcatagagtgataagttgacttcatagtttaggagaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3652314 |
cataacacaaacacaattgtatatatattttgattcttgattaactattaatcaacattatttcatagagtgataagttgacttcatagtttaggagaga |
3652413 |
T |
|
| Q |
101 |
aacataggagttgaagcaaccctatttcactctaaaattgagatcagatccacctaacttctcttcaatgaccttggacaatttttcaaccattgaaggt |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3652414 |
aacataggagttgtagcaaccctatttcactctaaaattgagatcagatccacctaacttctcttcaatgaccttggacaatttttcaaccattgaaggt |
3652513 |
T |
|
| Q |
201 |
gaaagataattactccaatc |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3652514 |
gaaagataattactccaatc |
3652533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 156 - 221
Target Start/End: Complemental strand, 15751740 - 15751675
Alignment:
| Q |
156 |
aacttctcttcaatgaccttggacaatttttcaaccattgaaggtgaaagataattactccaatct |
221 |
Q |
| |
|
|||||||||||||||| ||||| | |||||| ||||||||||| ||||| || ||| |||||||| |
|
|
| T |
15751740 |
aacttctcttcaatgattttggatagtttttctaccattgaaggagaaaggtagttaatccaatct |
15751675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University