View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21070_high_6 (Length: 450)
Name: NF21070_high_6
Description: NF21070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21070_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 6e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 218 - 435
Target Start/End: Original strand, 12504115 - 12504320
Alignment:
| Q |
218 |
agctattagtgaatttgttcgcttttaaatttaaagcactgaaaaattggttggacaatttgcttggtgtaaattgtctttagttcgaccccacagctaa |
317 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12504115 |
agctattagtgaatttgttcgctttcaaatttaaagcactgaaaaattggttggacaatttgcttggtgtaaatt---------tcgaccccacagctaa |
12504205 |
T |
|
| Q |
318 |
tctataagtgaaattataaaaacgtgagacaattttaggctgaatctgtgcacgatcaaatttaatgcgctgaaatattattggttatacatctttttta |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |||||||||| |||||||||||||| |||||| |
|
|
| T |
12504206 |
tctataagtgaaattataaaaacgtgagacaattttaggctgaatctgtacacgaccaaatttagtgcgctgaaa---tattggttatacatacttttta |
12504302 |
T |
|
| Q |
418 |
cttttaatcctattaatt |
435 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
12504303 |
cttttaatcctattaatt |
12504320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University