View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21070_low_13 (Length: 364)
Name: NF21070_low_13
Description: NF21070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21070_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 12 - 348
Target Start/End: Original strand, 7942472 - 7942808
Alignment:
| Q |
12 |
aaaggaagcaggaaacatcaaggtacaaattggtcttatttttcactgaattaaaatagcaatatacttgaattagctatataaattggtattattttgt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7942472 |
aaaggaagcaggaaacatcaaggtacaaattggtcttatttttcactgaattaaaatagctatgtacttgaattagctatataaattggtgttattttgt |
7942571 |
T |
 |
| Q |
112 |
tcccatcagaggtttctcccatctgaattcgggatcgacgttgaccgtcaccatgccgttgagccggtagctagcttttttgggcaaaaagcaaaaatca |
211 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7942572 |
tcctatcagaggtttctcccatctgaattcgggatcgacgttgaccgtcaccatgctgttgagccggtagctagcttttttgggcaaaaagcaaaaatca |
7942671 |
T |
 |
| Q |
212 |
gaagggcaattgaagctgaaggaattccttatacttatatttcctctaacgcctttgccggatacttcctccctacattaggacaacaaaatgtcacatc |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7942672 |
gaagggcaattgaagctgaaggaattccttacacttatatttcctctaacgcctttgccggatacttcctccctacattaggacaacaaaatgtcacatc |
7942771 |
T |
 |
| Q |
312 |
tcctccccgcgataaagtggtcattcttggagatgga |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7942772 |
tcctccccgcgataaagtggtcattcttggagatgga |
7942808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University