View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21070_low_16 (Length: 291)
Name: NF21070_low_16
Description: NF21070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21070_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 138 - 285
Target Start/End: Original strand, 1366154 - 1366301
Alignment:
| Q |
138 |
ccgaaataattcagtatatagttgaacattgccacctcttcaattttgtttaagcaactaggagttaaattattccaattccttttnnnnnnnnttgttt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1366154 |
ccgaaataattcagtatatagttgaacattgccacatcttcaatttagtttaagcaactaggagttaaattattccaattcctttaaaaaaaaattgttt |
1366253 |
T |
 |
| Q |
238 |
taacttttctcaaaggctataaattgggttctgcatttttcttctcac |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
1366254 |
taacttttctcaaaggctataaattgggttccccattttttttctcac |
1366301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 19 - 97
Target Start/End: Original strand, 1366023 - 1366101
Alignment:
| Q |
19 |
agagttagatggttgtatcttaaagttcttaagcataaaaatggaatttgacaagaattggatgtctaattggatccgg |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1366023 |
agagttagatggttgtatcttaaagttcttaagcataaaaatggaatttgacaagaattggatgtctaattggatccgg |
1366101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University