View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21070_low_20 (Length: 250)
Name: NF21070_low_20
Description: NF21070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21070_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 153 - 241
Target Start/End: Original strand, 27425219 - 27425307
Alignment:
| Q |
153 |
aaacattattctagatggtggtgtatgagtaaaagatcaaatagagactttgatttgtactttgaggcgtgataagtttgggcctatgc |
241 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27425219 |
aaacattattctagatggaggtgtatgagtaaaagatcaaatagagactttgatttgtactttgaggcgtcataagtttgggcctatgc |
27425307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 27425014 - 27425086
Alignment:
| Q |
1 |
ttaatatttgtcatttaaaataaaaacgcgtattagtctaacttttaatagttaacattattctagatggagt |
73 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
27425014 |
ttaatatttatcatttaaaataaaaacgtgtattagtctaacttttaatagttaacattattttagatggagt |
27425086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 101 - 143
Target Start/End: Complemental strand, 28805779 - 28805737
Alignment:
| Q |
101 |
ggcaggggttcaaaccccagatacccaacttctccacatttaa |
143 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
28805779 |
ggcaggggttcaaacccctgatacccnacttctccacatttaa |
28805737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 101 - 143
Target Start/End: Original strand, 22774088 - 22774130
Alignment:
| Q |
101 |
ggcaggggttcaaaccccagatacccaacttctccacatttaa |
143 |
Q |
| |
|
|||||||||||||||||| || |||| |||||||||||||||| |
|
|
| T |
22774088 |
ggcaggggttcaaaccccggacaccccacttctccacatttaa |
22774130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 71 - 99
Target Start/End: Original strand, 28021224 - 28021252
Alignment:
| Q |
71 |
agtccccgtgagtttagctcagttggtag |
99 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28021224 |
agtccccgtgagtttagctcagttggtag |
28021252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 73 - 109
Target Start/End: Original strand, 6582269 - 6582305
Alignment:
| Q |
73 |
tccccgtgagtttagctcagttggtagtggcaggggt |
109 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
6582269 |
tccccgtgagtttagctcagttggtagggacaggggt |
6582305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University