View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21070_low_23 (Length: 248)
Name: NF21070_low_23
Description: NF21070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21070_low_23 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 17 - 217
Target Start/End: Original strand, 27424082 - 27424287
Alignment:
| Q |
17 |
aagtatatagtaactttgcaatgtactcatcttgaagtgttccatgtgtgaattgggattacgcagtatattgg----tggttgaaagtggaaatctacc |
112 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
27424082 |
aagtatatagtaattttgcaatgtactcatcttgaagtgttccatgtgtgaattgggattacacagtatattggttggtggttgaaagtggaaatctacc |
27424181 |
T |
 |
| Q |
113 |
tgtaacaattttgaggcagctgcagtaatttaattttctcttttgagtccaaatatctttcatgtcttgaactgtgatattatctcctccc-tcaaccta |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27424182 |
tgtaacaattttgaggcagctgcagtaatttaattttctcttttgagtccaaatatctttcatgtcttgaactgtgatattatctcctcccttcaaccta |
27424281 |
T |
 |
| Q |
212 |
aacttt |
217 |
Q |
| |
|
|||||| |
|
|
| T |
27424282 |
aacttt |
27424287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University