View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21070_low_26 (Length: 210)
Name: NF21070_low_26
Description: NF21070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21070_low_26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 59; Significance: 3e-25; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 130 - 192
Target Start/End: Complemental strand, 34362461 - 34362399
Alignment:
| Q |
130 |
gcatcttcatggtttctgttaaaagataaactttgtctaaatatcttatttgtaggccaagaa |
192 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34362461 |
gcatcttcatggtttctcttaaaagataaactttgtctaaatatcttatttgtaggccaagaa |
34362399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 20 - 49
Target Start/End: Complemental strand, 34362571 - 34362542
Alignment:
| Q |
20 |
atgtgggtgaggatttttttggtggttaaa |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34362571 |
atgtgggtgaggatttttttggtggttaaa |
34362542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University