View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21070_low_27 (Length: 202)
Name: NF21070_low_27
Description: NF21070
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21070_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 19 - 189
Target Start/End: Original strand, 37627058 - 37627228
Alignment:
| Q |
19 |
aagttttgcaagagataggccaacagagtgtttcttatggacagtggggatatttccagaaccatgttattcaaattgtcgtattgaacttacaaaaacc |
118 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37627058 |
aagttttgcaagagatagaccaacagagtgtttcttatggacagtggggatatttccagaaccatgttattcaaattgtcgtattgaacttacaaaaacc |
37627157 |
T |
|
| Q |
119 |
atttgcattttggatgttattgatgacatctttgacaattatggtacattagaggatcttgttcttctcac |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37627158 |
atttgcattttggatgttattgatgacatctttgacaattatggtacattagaggatcttgttcttttcac |
37627228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 21 - 184
Target Start/End: Original strand, 37618646 - 37618809
Alignment:
| Q |
21 |
gttttgcaagagataggccaacagagtgtttcttatggacagtggggatatttccagaaccatgttattcaaattgtcgtattgaacttacaaaaaccat |
120 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||||||||||| |||||||||| || || ||||||||||||||||| |
|
|
| T |
37618646 |
gttttgcaagagatagaccaacagagtgcttcttatggacagtagggatatttccagaaccatgtcattcaaattgccgcatagaacttacaaaaaccat |
37618745 |
T |
|
| Q |
121 |
ttgcattttggatgttattgatgacatctttgacaattatggtacattagaggatcttgttctt |
184 |
Q |
| |
|
|| |||||| || || ||||| |||||||||| |||||| |||||||| || ||||||||| |
|
|
| T |
37618746 |
atgtattttgctagtaatggatgatatctttgacacttatggaacattagatgaacttgttctt |
37618809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University