View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21071_high_3 (Length: 393)
Name: NF21071_high_3
Description: NF21071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21071_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 43213297 - 43213488
Alignment:
| Q |
1 |
ctacctttacatgtggaaccttggtttatttatcgaaaaaacggggcttggttttggcttagattgctactatcttgatatcgaccttgaattagatgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43213297 |
ctacctttacatgtggaaccttggtttatttatcgaaaaaacggggcttggttttggcttagattgctactatcttgatatcgaccttgaattagatgca |
43213396 |
T |
 |
| Q |
101 |
ctcaacattgcttttttgaagttacttacatacacaaatgtattttttgttggatatataaatccgggcaaaacaattttttgttgccgact |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43213397 |
ctcaacattgcttttttgaagttacttacatacacaaatgtattttttgttggatatataaatccgggcaaaacaattttttgttgccgact |
43213488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 199 - 369
Target Start/End: Original strand, 43213552 - 43213715
Alignment:
| Q |
199 |
aaggactactgcaatgccacttgaatgcagtaaaatacaacggtttacaataaatatttattatgacgtaacttgatctatttggttgatcatatttaat |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
43213552 |
aaggactactgcaatgccacttgaatgcagtaaaatacaacggtttacaataaa----tattatgacgtaacttgatctatttaattgatcatatttaat |
43213647 |
T |
 |
| Q |
299 |
gggttaatatttgttgttgttgttgaataagcaaatttagttgagtgttttttaagacacacgagggagaa |
369 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43213648 |
gggttaatat---ttgttgttgttgaataagcaaatttagttgagtgttttttaagacacacaagggagaa |
43213715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University