View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21071_high_5 (Length: 275)
Name: NF21071_high_5
Description: NF21071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21071_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 52985990 - 52985728
Alignment:
| Q |
1 |
atgtaatagcagtagaactgggannnnnnnngctgaacaccataactctgaaattgtaggctgtgcgggcattaggaaacgttgccgttgattcccctat |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52985990 |
atgtaatagcagtagaactgggattttttttgctgaacaccataactctgaaattgtaggctgtgcgggcattaggaaacgttgccgttgattcccctat |
52985891 |
T |
|
| Q |
101 |
gtgccgtgatcttgttttcagttatggtgccttgatcccattgttatcccagttcaatgatcaaacaaggctttctatgctgagagttgccgttgttttt |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52985890 |
gtgccgtgatcttgttttcagtcatggtgccttgatcccattgctatcccagttcaatgatcaaacaaggctttctatgctgagagttgccgttgttttt |
52985791 |
T |
|
| Q |
201 |
gaaaaattaaaactgacaccgtaagaagatctttatatgtgtattaattaatagtaggatatt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52985790 |
gaaaaattaaaactgacaccgtaagaagatctttatatgtgtattaattaatagtaggatatt |
52985728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 44 - 191
Target Start/End: Original strand, 55635245 - 55635392
Alignment:
| Q |
44 |
aactctgaaattgtaggctgtgcgggcattaggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgccttgatcccattg |
143 |
Q |
| |
|
|||||||||||||||||||| | ||||||| ||||||||||||| ||| |||||| |||||||||||||||| ||||| |||||||| |||| ||| || |
|
|
| T |
55635245 |
aactctgaaattgtaggctgcgtgggcattgggaaacgttgccggtgagtccccttggtgccgtgatcttgttctcagtcatggtgccctgattccactg |
55635344 |
T |
|
| Q |
144 |
ttatcccagttcaatgatcaaacaaggctttctatgctgagagttgcc |
191 |
Q |
| |
|
||||||||||| ||||| ||| |||||||||||||||||||| ||||| |
|
|
| T |
55635345 |
ttatcccagttgaatgagcaagcaaggctttctatgctgagaattgcc |
55635392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 51 - 191
Target Start/End: Complemental strand, 55665699 - 55665559
Alignment:
| Q |
51 |
aaattgtaggctgtgcgggcattaggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgccttgatcccattgttatccc |
150 |
Q |
| |
|
|||||| |||||||| ||||||| |||||| |||||| ||||||||||| |||||||||||||||||||||| ||||||| ||||||| ||||| ||| |
|
|
| T |
55665699 |
aaattgcaggctgtgtgggcattgggaaacattgccggtgattcccctaggtgccgtgatcttgttttcagtcatggtgcgctgatcccgctgttaaccc |
55665600 |
T |
|
| Q |
151 |
agttcaatgatcaaacaaggctttctatgctgagagttgcc |
191 |
Q |
| |
|
|||| ||||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
55665599 |
agttgaatgagcaagcaaagctttctatgctgagagttgcc |
55665559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 44 - 190
Target Start/End: Complemental strand, 55659494 - 55659348
Alignment:
| Q |
44 |
aactctgaaattgtaggctgtgcgggcattaggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgccttgatcccattg |
143 |
Q |
| |
|
|||||||||||||||||||| | || |||| ||||| ||||||| ||||||||||| || |||||||||||| ||||| ||||||| |||||||| || |
|
|
| T |
55659494 |
aactctgaaattgtaggctgcgtggacattgggaaatgttgccggtgattcccctagttgtcgtgatcttgttctcagtcatggtgcgttgatcccgctg |
55659395 |
T |
|
| Q |
144 |
ttatcccagttcaatgatcaaacaaggctttctatgctgagagttgc |
190 |
Q |
| |
|
||||||||||| ||||| ||| ||| |||||||||||||||| |||| |
|
|
| T |
55659394 |
ttatcccagttgaatgagcaagcaaagctttctatgctgagaattgc |
55659348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 48 - 167
Target Start/End: Complemental strand, 54862310 - 54862191
Alignment:
| Q |
48 |
ctgaaattgtaggctgtgcgggcattaggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgccttgatcccattgttat |
147 |
Q |
| |
|
||||| ||||||||| | ||||||| |||||| |||| | ||||||||||| ||| |||||||||||| ||||| |||||||| ||||||| |||||| |
|
|
| T |
54862310 |
ctgaatttgtaggctccgtgggcattgggaaacattgctggtgattcccctaggtgtcgtgatcttgttctcagtcatggtgccctgatcccgctgttat |
54862211 |
T |
|
| Q |
148 |
cccagttcaatgatcaaaca |
167 |
Q |
| |
|
||||||| ||||| |||||| |
|
|
| T |
54862210 |
cccagttgaatgaccaaaca |
54862191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 36 - 194
Target Start/End: Original strand, 54627019 - 54627177
Alignment:
| Q |
36 |
aacaccataactctgaaattgtaggctgtgcgggcattaggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgccttga |
135 |
Q |
| |
|
||||||| |||||||||||||||||||| | ||||||| |||||| |||| | ||||||||||| |||||||||||||| ||||| | |||||| ||| |
|
|
| T |
54627019 |
aacaccaaaactctgaaattgtaggctgcgtgggcattgggaaacattgctggtgattcccctagaggccgtgatcttgttctcagtcacggtgccctga |
54627118 |
T |
|
| Q |
136 |
tcccattgttatcccagttcaatgatcaaacaaggctttctatgctgagagttgccgtt |
194 |
Q |
| |
|
||| | | ||||||||| | ||||| ||| | |||||| || ||||||| ||||||| |
|
|
| T |
54627119 |
tcctacttttatcccagctgaatgagcaagaagggctttataggctgagaaatgccgtt |
54627177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 75 - 190
Target Start/End: Complemental strand, 3672027 - 3671912
Alignment:
| Q |
75 |
ggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgccttgatcccattgttatcccagttcaatgatcaaacaaggcttt |
174 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||| ||||| |||||||| ||||||| |||||||||| || ||||| | ||| ||| |
|
|
| T |
3672027 |
ggaaacgttgcctgtgattcccctagttgccgtgatcttgttctcagtcatggtgccatgatcccgctgttatcccacttgaatgagcttacagatattt |
3671928 |
T |
|
| Q |
175 |
ctatgctgagagttgc |
190 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3671927 |
ctatgctgagagttgc |
3671912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 32 - 160
Target Start/End: Original strand, 9889518 - 9889646
Alignment:
| Q |
32 |
gctgaacaccataactctgaaattgtaggctgtgcgggcattaggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgcc |
131 |
Q |
| |
|
||||||||| | ||||||||||||||||||| | |||| || |||||||||||| ||||||||||| |||||| |||||||| ||||| |||||||| |
|
|
| T |
9889518 |
gctgaacactaaaactctgaaattgtaggcttcgtgggcgttgggaaacgttgcctgtgattcccctagttgccgttatcttgttctcagtcatggtgcc |
9889617 |
T |
|
| Q |
132 |
ttgatcccattgttatcccagttcaatga |
160 |
Q |
| |
|
||||||| |||||||||| || ||||| |
|
|
| T |
9889618 |
atgatcccgctgttatcccacttgaatga |
9889646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 44 - 185
Target Start/End: Original strand, 13401423 - 13401564
Alignment:
| Q |
44 |
aactctgaaattgtaggctgtgcgggcattaggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgccttgatcccattg |
143 |
Q |
| |
|
||||||| |||||||||||||| ||||||| ||||| ||||| | |||||| |||| |||||| ||||||||| | || |||||||| ||||||| || |
|
|
| T |
13401423 |
aactctgtaattgtaggctgtgtgggcattgggaaatgttgctggtgattcacctaggtgccgcgatcttgttcttagccatggtgccctgatcccgctg |
13401522 |
T |
|
| Q |
144 |
ttatcccagttcaatgatcaaacaaggctttctatgctgaga |
185 |
Q |
| |
|
||| ||||||| ||||| || ||| |||||| ||||||||| |
|
|
| T |
13401523 |
ttaacccagttgaatgagcaggcaaagctttcaatgctgaga |
13401564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University