View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21071_low_6 (Length: 275)

Name: NF21071_low_6
Description: NF21071
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21071_low_6
NF21071_low_6
[»] chr4 (7 HSPs)
chr4 (1-263)||(52985728-52985990)
chr4 (44-191)||(55635245-55635392)
chr4 (51-191)||(55665559-55665699)
chr4 (44-190)||(55659348-55659494)
chr4 (48-167)||(54862191-54862310)
chr4 (36-194)||(54627019-54627177)
chr4 (75-190)||(3671912-3672027)
[»] chr8 (1 HSPs)
chr8 (32-160)||(9889518-9889646)
[»] chr2 (1 HSPs)
chr2 (44-185)||(13401423-13401564)


Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 7)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 263
Target Start/End: Complemental strand, 52985990 - 52985728
Alignment:
1 atgtaatagcagtagaactgggannnnnnnngctgaacaccataactctgaaattgtaggctgtgcgggcattaggaaacgttgccgttgattcccctat 100  Q
    |||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52985990 atgtaatagcagtagaactgggattttttttgctgaacaccataactctgaaattgtaggctgtgcgggcattaggaaacgttgccgttgattcccctat 52985891  T
101 gtgccgtgatcttgttttcagttatggtgccttgatcccattgttatcccagttcaatgatcaaacaaggctttctatgctgagagttgccgttgttttt 200  Q
    |||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52985890 gtgccgtgatcttgttttcagtcatggtgccttgatcccattgctatcccagttcaatgatcaaacaaggctttctatgctgagagttgccgttgttttt 52985791  T
201 gaaaaattaaaactgacaccgtaagaagatctttatatgtgtattaattaatagtaggatatt 263  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52985790 gaaaaattaaaactgacaccgtaagaagatctttatatgtgtattaattaatagtaggatatt 52985728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 44 - 191
Target Start/End: Original strand, 55635245 - 55635392
Alignment:
44 aactctgaaattgtaggctgtgcgggcattaggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgccttgatcccattg 143  Q
    |||||||||||||||||||| | ||||||| ||||||||||||| ||| ||||||  |||||||||||||||| ||||| |||||||| |||| ||| ||    
55635245 aactctgaaattgtaggctgcgtgggcattgggaaacgttgccggtgagtccccttggtgccgtgatcttgttctcagtcatggtgccctgattccactg 55635344  T
144 ttatcccagttcaatgatcaaacaaggctttctatgctgagagttgcc 191  Q
    ||||||||||| ||||| ||| |||||||||||||||||||| |||||    
55635345 ttatcccagttgaatgagcaagcaaggctttctatgctgagaattgcc 55635392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 51 - 191
Target Start/End: Complemental strand, 55665699 - 55665559
Alignment:
51 aaattgtaggctgtgcgggcattaggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgccttgatcccattgttatccc 150  Q
    |||||| |||||||| ||||||| |||||| |||||| ||||||||||| |||||||||||||||||||||| |||||||  |||||||  ||||| |||    
55665699 aaattgcaggctgtgtgggcattgggaaacattgccggtgattcccctaggtgccgtgatcttgttttcagtcatggtgcgctgatcccgctgttaaccc 55665600  T
151 agttcaatgatcaaacaaggctttctatgctgagagttgcc 191  Q
    |||| ||||| ||| ||| ||||||||||||||||||||||    
55665599 agttgaatgagcaagcaaagctttctatgctgagagttgcc 55665559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 44 - 190
Target Start/End: Complemental strand, 55659494 - 55659348
Alignment:
44 aactctgaaattgtaggctgtgcgggcattaggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgccttgatcccattg 143  Q
    |||||||||||||||||||| | || |||| ||||| ||||||| |||||||||||  || |||||||||||| ||||| ||||||| ||||||||  ||    
55659494 aactctgaaattgtaggctgcgtggacattgggaaatgttgccggtgattcccctagttgtcgtgatcttgttctcagtcatggtgcgttgatcccgctg 55659395  T
144 ttatcccagttcaatgatcaaacaaggctttctatgctgagagttgc 190  Q
    ||||||||||| ||||| ||| ||| |||||||||||||||| ||||    
55659394 ttatcccagttgaatgagcaagcaaagctttctatgctgagaattgc 55659348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 48 - 167
Target Start/End: Complemental strand, 54862310 - 54862191
Alignment:
48 ctgaaattgtaggctgtgcgggcattaggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgccttgatcccattgttat 147  Q
    ||||| |||||||||  | ||||||| |||||| |||| | ||||||||||| ||| |||||||||||| ||||| |||||||| |||||||  ||||||    
54862310 ctgaatttgtaggctccgtgggcattgggaaacattgctggtgattcccctaggtgtcgtgatcttgttctcagtcatggtgccctgatcccgctgttat 54862211  T
148 cccagttcaatgatcaaaca 167  Q
    ||||||| ||||| ||||||    
54862210 cccagttgaatgaccaaaca 54862191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 36 - 194
Target Start/End: Original strand, 54627019 - 54627177
Alignment:
36 aacaccataactctgaaattgtaggctgtgcgggcattaggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgccttga 135  Q
    ||||||| |||||||||||||||||||| | ||||||| |||||| |||| | |||||||||||   |||||||||||||| ||||| | |||||| |||    
54627019 aacaccaaaactctgaaattgtaggctgcgtgggcattgggaaacattgctggtgattcccctagaggccgtgatcttgttctcagtcacggtgccctga 54627118  T
136 tcccattgttatcccagttcaatgatcaaacaaggctttctatgctgagagttgccgtt 194  Q
    ||| | | ||||||||| | ||||| |||  | |||||| || |||||||  |||||||    
54627119 tcctacttttatcccagctgaatgagcaagaagggctttataggctgagaaatgccgtt 54627177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 75 - 190
Target Start/End: Complemental strand, 3672027 - 3671912
Alignment:
75 ggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgccttgatcccattgttatcccagttcaatgatcaaacaaggcttt 174  Q
    ||||||||||||  |||||||||||  ||||||||||||||| ||||| |||||||| |||||||  |||||||||| || ||||| |  |||    |||    
3672027 ggaaacgttgcctgtgattcccctagttgccgtgatcttgttctcagtcatggtgccatgatcccgctgttatcccacttgaatgagcttacagatattt 3671928  T
175 ctatgctgagagttgc 190  Q
    ||||||||||||||||    
3671927 ctatgctgagagttgc 3671912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 32 - 160
Target Start/End: Original strand, 9889518 - 9889646
Alignment:
32 gctgaacaccataactctgaaattgtaggctgtgcgggcattaggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgcc 131  Q
    ||||||||| | |||||||||||||||||||  | |||| || ||||||||||||  |||||||||||  |||||| |||||||| ||||| ||||||||    
9889518 gctgaacactaaaactctgaaattgtaggcttcgtgggcgttgggaaacgttgcctgtgattcccctagttgccgttatcttgttctcagtcatggtgcc 9889617  T
132 ttgatcccattgttatcccagttcaatga 160  Q
     |||||||  |||||||||| || |||||    
9889618 atgatcccgctgttatcccacttgaatga 9889646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 44 - 185
Target Start/End: Original strand, 13401423 - 13401564
Alignment:
44 aactctgaaattgtaggctgtgcgggcattaggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgccttgatcccattg 143  Q
    ||||||| |||||||||||||| ||||||| ||||| ||||| | |||||| |||| |||||| ||||||||| | ||  |||||||| |||||||  ||    
13401423 aactctgtaattgtaggctgtgtgggcattgggaaatgttgctggtgattcacctaggtgccgcgatcttgttcttagccatggtgccctgatcccgctg 13401522  T
144 ttatcccagttcaatgatcaaacaaggctttctatgctgaga 185  Q
    ||| ||||||| ||||| ||  ||| |||||| |||||||||    
13401523 ttaacccagttgaatgagcaggcaaagctttcaatgctgaga 13401564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University