View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21072_high_29 (Length: 238)
Name: NF21072_high_29
Description: NF21072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21072_high_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 181 - 221
Target Start/End: Complemental strand, 43885073 - 43885033
Alignment:
| Q |
181 |
tatgtattgagatatttttaaatagagtatgtattgagaat |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43885073 |
tatgtattgagatatttttaaatagagtatgtattgagaat |
43885033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University