View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21072_low_19 (Length: 275)
Name: NF21072_low_19
Description: NF21072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21072_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 23 - 268
Target Start/End: Complemental strand, 34033894 - 34033649
Alignment:
| Q |
23 |
ggttcaacttgtcaacaatttcaagctgagactgtgaagcctcgaactcaaccctttgcatctcaccttgtagtctatcaacctgatcagaaattctcga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34033894 |
ggttcaacttgtcaacaatttcaagctgagactgtgaagcctcgaactcaaccctttgcatctcaccttgtagtctatcaacctgatcagaaattctcga |
34033795 |
T |
|
| Q |
123 |
tagcacttcagtatttgcaatagacagtgcagccagagaccttccaatatcccttgtaacttgctcaacttcctcgactatggaccggcatttaactagc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34033794 |
tagcacttcagtatttgcaatagacagtgcagccagagaccttccaatatcccttgtaacttgctcaacttcctcgactatggaccggcatttaactagc |
34033695 |
T |
|
| Q |
223 |
aagtagaaacggccgcggttcttgtacttctcaaccatattcttcg |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34033694 |
aagtagaaacggccgcggttcttgtacttctcaaccatattattcg |
34033649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 34 - 176
Target Start/End: Complemental strand, 15191781 - 15191639
Alignment:
| Q |
34 |
tcaacaatttcaagctgagactgtgaagcctcgaactcaaccctttgcatctcaccttgtagtctatcaacctgatcagaaattctcgatagcacttcag |
133 |
Q |
| |
|
||||| || ||||||||||| ||||||||||| || | ||||||||||||| | ||||||| | || |||||||||||| |||| || ||||| | |
|
|
| T |
15191781 |
tcaaccatgtcaagctgagattgtgaagcctcaaaattgaccctttgcatcttgctcagtagtctgttgacttgatcagaaattatcgacagtacttcgg |
15191682 |
T |
|
| Q |
134 |
tatttgcaatagacagtgcagccagagaccttccaatatccct |
176 |
Q |
| |
|
|||||| | |||||||||| |||||||||||||||||||||| |
|
|
| T |
15191681 |
tatttgtgagagacagtgcaaccagagaccttccaatatccct |
15191639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 46 - 175
Target Start/End: Complemental strand, 15210261 - 15210132
Alignment:
| Q |
46 |
agctgagactgtgaagcctcgaactcaaccctttgcatctcaccttgtagtctatcaacctgatcagaaattctcgatagcacttcagtatttgcaatag |
145 |
Q |
| |
|
|||||||| ||||||||||| |||| ||||||||||| |||| || ||||| | || || | ||||||||| ||||| | |||||||||| ||| | |
|
|
| T |
15210261 |
agctgagattgtgaagcctcacactcgaccctttgcatgtcactatgcagtctgttgacttggttagaaattcttgataggagttcagtatttccaagaa |
15210162 |
T |
|
| Q |
146 |
acagtgcagccagagaccttccaatatccc |
175 |
Q |
| |
|
||| |||||||||||||||||||||||| |
|
|
| T |
15210161 |
acacaacagccagagaccttccaatatccc |
15210132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University