View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21072_low_20 (Length: 269)
Name: NF21072_low_20
Description: NF21072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21072_low_20 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 11 - 269
Target Start/End: Complemental strand, 23821894 - 23821638
Alignment:
| Q |
11 |
gagatgaagagacaatgtagcaccatgtgtttgtggagatgctgctgctatgnnnnnnnnn-atctttcatggttgannnnnnnngccaaaagcaagcaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||| ||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
23821894 |
gagatgaagagacaatgtagcaccatgtgtttgtagagatgctgct---atgttttttttttatctttcatggttgattttttttgccaaaagcaagcaa |
23821798 |
T |
 |
| Q |
110 |
tttacaatttgtttcacattcttgcctctgcagggaagcaaagaaagatcccacaggacagcaggtttataagctcctggtaaacatccataaaggtttc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23821797 |
tttacaatttgtttcacattcttgcctctgcagggaagcaaagaaagatcccacaggacagcaggtttataagctcctggtaaacatccataaaggtttc |
23821698 |
T |
 |
| Q |
210 |
gaacaaatatccgagaaaattctggcagctgatagaattagaagagaagtatctgaatat |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23821697 |
gaacaaatatccgagaaaattctggcagctgatagaattagaagagaagtatctgaatat |
23821638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University