View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21072_low_22 (Length: 256)
Name: NF21072_low_22
Description: NF21072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21072_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 72; Significance: 8e-33; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 11 - 138
Target Start/End: Complemental strand, 16371163 - 16371036
Alignment:
| Q |
11 |
catcatcattttaaaagaaaaacacttcctgttacaggagaatgttaagannnnnnnnnnnnnnnncattttagaaaaatataacaattttatgtgatag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
16371163 |
catcatcattttaaaagaaaaacacttcctgttacaggagaatgttaggattttttatttttttttcattttagaaaaatataacaattttatgtgatag |
16371064 |
T |
 |
| Q |
111 |
catgcaacattttcatatattcttttta |
138 |
Q |
| |
|
|||||||||||||||||||||| ||||| |
|
|
| T |
16371063 |
catgcaacattttcatatattcatttta |
16371036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University