View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21072_low_23 (Length: 256)
Name: NF21072_low_23
Description: NF21072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21072_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 118 - 246
Target Start/End: Original strand, 43310177 - 43310305
Alignment:
| Q |
118 |
ccctaacagcaagcctctcattccgtcactgtttgtaggttaattattatttttcccaatattatcatttgctcacatatttcacaagtcacatccatca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43310177 |
ccctaacagcaagcctctcattccgtcactgattgtaggttaattattatttttcccaatattatcatttgctcacatatttcacaagtcacatccatca |
43310276 |
T |
|
| Q |
218 |
attgtccaccaccacgggtgttgatgatg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43310277 |
attgtccaccaccacgggtgttgatgatg |
43310305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University