View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21072_low_24 (Length: 253)
Name: NF21072_low_24
Description: NF21072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21072_low_24 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 19 - 253
Target Start/End: Original strand, 2927657 - 2927892
Alignment:
| Q |
19 |
aatagagtcaacttggagtgactagcacaggcagaagcagtgtccgaatgagtatctgttgccatcggggaaaa-gggattcaattagaatctgcgcccn |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||| ||||||||||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
2927657 |
aatagagtcaacttggagtgactagcacagacagaagcagtgtcagaacgagtatctgttgccatcggggaaaaagggattcaattagaatccgcgccca |
2927756 |
T |
 |
| Q |
118 |
nnnnnngaaacctaattttgttatgagacttctttttccgccctacgtttctgaaaaatcacacatgtgtccaaaaatatactttcgggtgggaaaagaa |
217 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2927757 |
aaaaaagaaaccttatttggttatgagacttctttttccgccctacgtttcttaaaaatcacacatgtgtccaaaaatatactttcgggtgggaaaagaa |
2927856 |
T |
 |
| Q |
218 |
gttcccttctgttatacaattgccactaaccagtcc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2927857 |
gttcccttctgttatacaattgccactaaccagtcc |
2927892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University