View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21072_low_28 (Length: 248)
Name: NF21072_low_28
Description: NF21072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21072_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 2389579 - 2389355
Alignment:
| Q |
18 |
cgagtttcgcctaagggtctgtttggcagcagatggccgtctgaatatgatatctcgcatccggaatgtcaatggcaagcctttcagtttctcctttgca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2389579 |
cgagtttcgcctaagggtctgtttggcagcagatggccgtctgaatatgatatctcgcatccggaatgtcaatggcaagcctttcagtttctcctttgca |
2389480 |
T |
|
| Q |
118 |
tttcatacatatttctccatatctgatatcaggtctgtatgctattccaacactttcaagataagatcaagatcgattattttatcaaggaatcaatctg |
217 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
2389479 |
tttcatacatatttctcgatatccgatatcaggtctgtatgctattccaacactttcaagataagatcaagatcaattattttatcaaggaatcaatctg |
2389380 |
T |
|
| Q |
218 |
ttctgaaatattaatttcttctcac |
242 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
2389379 |
ttctgaaatattaatttcttttcac |
2389355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University