View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21072_low_29 (Length: 244)
Name: NF21072_low_29
Description: NF21072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21072_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 6 - 240
Target Start/End: Complemental strand, 8413875 - 8413644
Alignment:
| Q |
6 |
cagagagtaaaaataaagagnnnnnnntgagaggaaaatggcgaagcctttggaattcgaatctgaaaccaaaaaccgtaaactgttgcgcatggcggtt |
105 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8413875 |
cagagagtaaaaataaagagaaaaaaatgagaggaaaatggcgaagcctttggaattcgaatctgaaaccaaaaaccgtaaactgttgcgcatggcggtt |
8413776 |
T |
 |
| Q |
106 |
gttacacgacggtccggacaccatcgaggagcttctcgaacggcatctagtgaagaaagttatcaacgatgatgaagaagaagaagagttgctgaatcgg |
205 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8413775 |
gttacacgacggtccggacaccgtcgaggagcttctcgaacggcatctagtgaagaaagttatcaacgatgatgaagaag---aagagttgctgaatcgg |
8413679 |
T |
 |
| Q |
206 |
cggcgactcacaagcacgcgccgagaagcactgag |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
8413678 |
cggcgactcacaagcacgcgccgagaagcactgag |
8413644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University