View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21072_low_36 (Length: 203)
Name: NF21072_low_36
Description: NF21072
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21072_low_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 34 - 187
Target Start/End: Original strand, 3712607 - 3712760
Alignment:
| Q |
34 |
agactaaatcatgatttactcaataaaaatagtacctttctagcaaccatttctgggtagttatcttgaaagagtgagagaatatggttagaagcaaccc |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3712607 |
agactaaatcatgatttactcaataaaaatagtacctttctagcaaccatttctgggtagttatcttgaaagagtgagagaatatggttagaagcaactc |
3712706 |
T |
 |
| Q |
134 |
ttaactctcttttaggcatatctttaagatcggtaacttgaataagagaattaa |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3712707 |
ttaactctcttttaggcatatctttaagatcggtaacttgaataagagaattaa |
3712760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 65 - 185
Target Start/End: Complemental strand, 26019463 - 26019343
Alignment:
| Q |
65 |
gtacctttctagcaaccatttctgggtagttatcttgaaagagtgagagaatatggttagaagcaacccttaactctcttttaggcatatctttaagatc |
164 |
Q |
| |
|
||||||| | |||||||||||| || |||||||||||||| | ||| | || || || || ||||||||||||| || ||||||||||| |||||||| |
|
|
| T |
26019463 |
gtaccttacgagcaaccatttcaggatagttatcttgaaacaatgacatgatttgatttgacacaacccttaactcactcttaggcatatccttaagatc |
26019364 |
T |
 |
| Q |
165 |
ggtaacttgaataagagaatt |
185 |
Q |
| |
|
|| |||||||| | |||||| |
|
|
| T |
26019363 |
agtgacttgaatcaaagaatt |
26019343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University