View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21074_high_28 (Length: 244)
Name: NF21074_high_28
Description: NF21074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21074_high_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 10 - 230
Target Start/End: Complemental strand, 10877255 - 10877036
Alignment:
| Q |
10 |
aatatgatttaaattttttctgtctccctcattcnnnnnnnttagtattaaataaacatattatatcagtttacnnnnnnnnnngggatgaatcaggtat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
10877255 |
aatatgatttaaattttttctgtctccctcattcaaaaaaattagtattaaataaacatattatatcagtttacttttttttt-gggatgaattaggtat |
10877157 |
T |
 |
| Q |
110 |
ctctatatgcaattgtataaactaatccattgaattgaatataacacgtgacaaaatttagttttcaaaataacgaaggaagaaaagaatttcgtcattc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10877156 |
ctctatatgcaattgtataaactaatccattgaattgaatataacacgtgacaaaatttagttttcaaaataacgaaggaagaaaagaatttcgtcattc |
10877057 |
T |
 |
| Q |
210 |
ttgatttgaagaaggtgacga |
230 |
Q |
| |
|
|||||||||||| |||||||| |
|
|
| T |
10877056 |
ttgatttgaagagggtgacga |
10877036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University