View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21074_low_22 (Length: 312)
Name: NF21074_low_22
Description: NF21074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21074_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 12 - 233
Target Start/End: Original strand, 52113277 - 52113498
Alignment:
| Q |
12 |
atgaatgggcctggtggcatattagcgcgaaaaatggttgatttgtatttgtgcattttacttctgaaatatttgtcgcggccgccttcgttgtagaaat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52113277 |
atgaatgggcctggtggcatattagcgcgaaaaatggttgatttgtatttgtgcattttgcttctgaaatatttgtcgcggccgccttcgttgtagaaat |
52113376 |
T |
|
| Q |
112 |
attcaagacggtctttgataggacctacgaatgggaggccgtaatctccagggattcttcgcattgaaagttttttgggtggttcgggtgaaactaatga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52113377 |
attcaagacggtctttgataggacctacgaatgggaggccgtaatctccagggattcttcgcattggaagttttttgggtggttcgggtgaaactaatga |
52113476 |
T |
|
| Q |
212 |
cgatgttgtgtctgtgccggac |
233 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
52113477 |
cgatgttgtgtctgtgccggac |
52113498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University