View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21074_low_26 (Length: 293)
Name: NF21074_low_26
Description: NF21074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21074_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 16 - 291
Target Start/End: Original strand, 3645273 - 3645546
Alignment:
| Q |
16 |
tatggacaaaattttaagatnnnnnnnntgtagttatatatgtgtctttagttgtttgaaatcgcttaaaataataccttcgtgctatgaatttggcttt |
115 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3645273 |
tatggacaaaattttaagataaaaaaaatgtagttatat--gtgtctttagttgtttgaaatcgcttaaaataataccttcgtgctatgaatttggcttt |
3645370 |
T |
 |
| Q |
116 |
attgaagtaaaacccttcannnnnnnattggcaggttttgaaattgtggttggtgacacaaaatctgtcttttattattgctggtgccactgttgttacc |
215 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3645371 |
attgaagtaaaacccttcatttttttattggcaggttttgaaattgtggttggtgacacaaaatctgtcttttattattgctggtgccactgttgttacc |
3645470 |
T |
 |
| Q |
216 |
ttacttgtctactcatctttgaagtttacaaatttcccagttttcttattacttgtagtcataatcaatatctgtg |
291 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3645471 |
ttactagtctactcatctttgaagtttacaaatttcccagttttcttattacttgtagtcataatcaatatctgtg |
3645546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 142 - 291
Target Start/End: Original strand, 3636145 - 3636294
Alignment:
| Q |
142 |
attggcaggttttgaaattgtggttggtgacacaaaatctgtcttttattattgctggtgccactgttgttaccttacttgtctactcatctttgaagtt |
241 |
Q |
| |
|
|||||||||| ||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3636145 |
attggcaggtattgcaattgtggctggtgacacaaaatctgtcttttattattgctggtgccactgtagttaccttacttgtctactcatctttgaagtt |
3636244 |
T |
 |
| Q |
242 |
tacaaatttcccagttttcttattacttgtagtcataatcaatatctgtg |
291 |
Q |
| |
|
|||||||||| ||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
3636245 |
tacaaatttcacagttttcttattacttgtggtgataatcaatatctgtg |
3636294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University