View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21075_high_5 (Length: 293)
Name: NF21075_high_5
Description: NF21075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21075_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 16 - 286
Target Start/End: Original strand, 42410950 - 42411220
Alignment:
| Q |
16 |
taaatttcattaagaaaaatgttaacaagaatatcacatgttcacatagaaaatgtaactttcatataaaaaataaggtatttattattttgacaaatat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
42410950 |
taaatttcattaagaaaaatgttaacaagaatatcacatgttcacatagaaaatgtaactttcaaataaaaaataaggtatttattattttgacaaatat |
42411049 |
T |
 |
| Q |
116 |
tttagttgcatttcaaagataaaatttcttttgataaattcttttaattaatgtccttaagatatttgttaacataactcatacaataacaacctatcaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42411050 |
tttagttgcatttcaaagataaaatttcttttgataaattcttttaattaacgtccataagaaatttgttaacatgactcatacaataacaacctatcaa |
42411149 |
T |
 |
| Q |
216 |
tgtcatatagaatttaagggttaataagttttttcatctctaaaaaattaccaaattttgtttttcatctc |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42411150 |
tgtcatatagaatttaagggttaataagttttttcatctctaaaaaattatcaaattttgtttttcatctc |
42411220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University