View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21075_high_6 (Length: 270)
Name: NF21075_high_6
Description: NF21075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21075_high_6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 7 - 270
Target Start/End: Complemental strand, 55076865 - 55076602
Alignment:
| Q |
7 |
agcacaggaagcaacgagagcgagaaggaatattgataagaagaaacatgttttgagattagcgcaaaagacatcgcaagctttagtttgggtgaaagga |
106 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076865 |
agcaaaggaagaaacgagagcgagaaggaatattgataagaagaaacatgttttgagattagcgcaaaagacatcgcaagctttagtttgggtgaaagga |
55076766 |
T |
 |
| Q |
107 |
aacatgtgatagagtttgctgaaagagccggcggcataaccaaggatatttcccacggccatgaagaaagagaacatggcattgcccattctcattcgac |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
55076765 |
aacatgtgatagagtttgctgaaagagccggcggcataaccaaggatatttcccacggccatgaagaaagagaacatggcattgcccattctcattctac |
55076666 |
T |
 |
| Q |
207 |
ggtgatcaccggcagcaaggtcaccaaggaaggcacgacatggtccttgaagcatattgttggc |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
55076665 |
ggtgatcaccggcagcaaggtcaccaaggaaggcacgacagggtccttgaagcatattgttggc |
55076602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 131 - 270
Target Start/End: Original strand, 15125312 - 15125451
Alignment:
| Q |
131 |
gagccggcggcataaccaaggatatttcccacggccatgaagaaagagaacatggcattgcccattctcattcgacggtgatcaccggcagcaaggtcac |
230 |
Q |
| |
|
||||| || ||||||||||||| ||| || ||||||||||| ||||||||||| ||||||| ||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
15125312 |
gagccagcagcataaccaaggacattaccgacggccatgaaaaaagagaacatcccattgccaattctcattcgacggtgatcaccaccagcgaggtcac |
15125411 |
T |
 |
| Q |
231 |
caaggaaggcacgacatggtccttgaagcatattgttggc |
270 |
Q |
| |
|
||| |||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
15125412 |
caatgaaggcacgacaaggtccttgaagcatattattggc |
15125451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 86 - 168
Target Start/End: Original strand, 43665606 - 43665688
Alignment:
| Q |
86 |
gctttagtttgggtgaaaggaaacatgtgatagagtttgctgaaagagccggcggcataaccaaggatatttcccacggccat |
168 |
Q |
| |
|
||||| |||| |||||| ||||||| |||| ||||||||||| ||| |||||||| ||||| ||||| || || |||||||| |
|
|
| T |
43665606 |
gcttttgttttggtgaacggaaacacgtgaaagagtttgctgtaagcaccggcggcgtaaccgaggatgttaccgacggccat |
43665688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University