View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21075_low_10 (Length: 239)
Name: NF21075_low_10
Description: NF21075
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21075_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 20 - 226
Target Start/End: Complemental strand, 37417401 - 37417195
Alignment:
| Q |
20 |
gaatttaaccttcgtctttgtaatttatagaatttgaattttccgtttcgcattgttgcgtgatttgaataatgtgatcgaattttcacgatcggtgttt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37417401 |
gaatttaaccttcgtctttgtaatttatagaatttgaattttccgttttgcattgttgcgtgatttcaataatgtgatcgaattttcacgatcggtgttt |
37417302 |
T |
 |
| Q |
120 |
ttataatgtgatttgaatctcgatctgaattattagatttttgatttgatctgaactgtcgttgtctggagtagatctgaacacgtgtgtactgaacgtg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37417301 |
ttataatgtgatttgaatctcgatctgaattattagatttttgatttgatctgaactgtcgttgtctggagtagatctgaacacgtgtgtactgaacgtg |
37417202 |
T |
 |
| Q |
220 |
atgatgt |
226 |
Q |
| |
|
||||||| |
|
|
| T |
37417201 |
atgatgt |
37417195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University