View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21078_high_10 (Length: 379)
Name: NF21078_high_10
Description: NF21078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21078_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 18 - 357
Target Start/End: Original strand, 48032586 - 48032923
Alignment:
| Q |
18 |
cctctttcgacgaaaaaccctaaattatctatcatcccaatcccttcttctccatttcctcaatttcattcccttaatttcccaattccgcgatcccaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48032586 |
cctctttcgacgaaaaaccctaaattatctatcatcccaatcccttcttctccatttcctcaatttcattcccttaatttcccaattccgcgatcccaat |
48032685 |
T |
 |
| Q |
118 |
aattctctccctcagctatgtcttccgagatcgaggtcgtcgaggaggttcaatctcgccgcgatcaacaatcgccaccgnnnnnnnnnnnnnnnnnttc |
217 |
Q |
| |
|
||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
48032686 |
aat--tctcactcagctatgtcttccgagatcgaggtcgtcgaggaggttcaatctcgccgcgatcaacaatcgccaccgtcatcatcatcatcatcttc |
48032783 |
T |
 |
| Q |
218 |
cgcggtcgtcgacgaagtcgccagccggaacgacgtgtacactgccgcggcttatggggatttggagaagttacatagattggtggagattgaaggttgt |
317 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48032784 |
cgccgtcgtcgacgaagtcgccagccggaacgacgtgtacactgccgcggcttatggggatttggagaagctacatagattggtggagattgaaggttgt |
48032883 |
T |
 |
| Q |
318 |
cttgttaacgagcctgatggtttgggttactacgctcttc |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48032884 |
cttgttaacgagcctgatggtttgggttactacgctcttc |
48032923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 6e-16; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 252 - 351
Target Start/End: Complemental strand, 51115969 - 51115870
Alignment:
| Q |
252 |
gtgtacactgccgcggcttatggggatttggagaagttacatagattggtggagattgaaggttgtcttgttaacgagcctgatggtttgggttactacg |
351 |
Q |
| |
|
||||||||||| || |||||||| |||||||||||| | | ||||||||||||| || ||||| || |||| ||||||||||||||||||||| |||| |
|
|
| T |
51115969 |
gtgtacactgcggctgcttatggagatttggagaagctgcgtagattggtggagcaagagggttgcctcgttaccgagcctgatggtttgggttattacg |
51115870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 267 - 357
Target Start/End: Complemental strand, 51106618 - 51106528
Alignment:
| Q |
267 |
gcttatggggatttggagaagttacatagattggtggagattgaaggttgtcttgttaacgagcctgatggtttgggttactacgctcttc |
357 |
Q |
| |
|
||||||| |||||| |||||| ||| ||||||||||||| || ||||| || |||| ||||||||||| | |||||||||||| |||| |
|
|
| T |
51106618 |
gcttatgaggatttagagaagctacgtagattggtggagcaagagggttgcctcgttaccgagcctgatgctacgggttactacgcgcttc |
51106528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University