View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21078_high_14 (Length: 338)
Name: NF21078_high_14
Description: NF21078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21078_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 5e-44; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 128 - 230
Target Start/End: Complemental strand, 1560181 - 1560079
Alignment:
| Q |
128 |
tcatatcctacattgtcaagtgttttacttatcttttcaaaacgatatttccctatttctttttatgagtacttaaaacatcttcaatggaaggtcctta |
227 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1560181 |
tcatatcctacattgtcaagtgtttcacttatcttttcaagacgatatttccctatttctttttatgagtacttaaaacatctccaatggaaggtcctta |
1560082 |
T |
 |
| Q |
228 |
ctt |
230 |
Q |
| |
|
||| |
|
|
| T |
1560081 |
ctt |
1560079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 21 - 103
Target Start/End: Complemental strand, 1560277 - 1560195
Alignment:
| Q |
21 |
atgtaatgtctatatcaactgatttattcacatgaataaatatttttaggagattgtttatggaatgaaggtgattttatata |
103 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
1560277 |
atgtaatgtctctatcaactgatttattcacatgaataaatatttttaggatattgtttatgaaatgaaggtgattttatata |
1560195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University