View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21078_low_24 (Length: 204)
Name: NF21078_low_24
Description: NF21078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21078_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 21 - 103
Target Start/End: Complemental strand, 1560277 - 1560195
Alignment:
| Q |
21 |
atgtaatgtctatatcaactgatttattcacatgaataaatatttttaggagattgtttatggaatgaaggtgattttatata |
103 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
1560277 |
atgtaatgtctctatcaactgatttattcacatgaataaatatttttaggatattgtttatgaaatgaaggtgattttatata |
1560195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 128 - 190
Target Start/End: Complemental strand, 1560181 - 1560119
Alignment:
| Q |
128 |
tcatatcctacattgtcaagtgttttacttatcttttcaaaacgatatttccctatttctttt |
190 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1560181 |
tcatatcctacattgtcaagtgtttcacttatcttttcaagacgatatttccctatttctttt |
1560119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University