View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21078_low_24 (Length: 204)

Name: NF21078_low_24
Description: NF21078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21078_low_24
NF21078_low_24
[»] chr3 (2 HSPs)
chr3 (21-103)||(1560195-1560277)
chr3 (128-190)||(1560119-1560181)


Alignment Details
Target: chr3 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 21 - 103
Target Start/End: Complemental strand, 1560277 - 1560195
Alignment:
21 atgtaatgtctatatcaactgatttattcacatgaataaatatttttaggagattgtttatggaatgaaggtgattttatata 103  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||    
1560277 atgtaatgtctctatcaactgatttattcacatgaataaatatttttaggatattgtttatgaaatgaaggtgattttatata 1560195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 128 - 190
Target Start/End: Complemental strand, 1560181 - 1560119
Alignment:
128 tcatatcctacattgtcaagtgttttacttatcttttcaaaacgatatttccctatttctttt 190  Q
    ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||    
1560181 tcatatcctacattgtcaagtgtttcacttatcttttcaagacgatatttccctatttctttt 1560119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University