View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21079_high_5 (Length: 293)
Name: NF21079_high_5
Description: NF21079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21079_high_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 34017306 - 34017576
Alignment:
| Q |
1 |
atcggaaaccttgagattcccatcggcgtcgaggaggagattctgcggtttaagatcacggtgagcgacgccattacggtggcagaaacgtaacgcagag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34017306 |
atcggaaaccttgagattcccatcggcgtcgaggaggagattttgcggtttaagatcacggtgagcgacgccgttacggtggcagaaacgtaacgcagag |
34017405 |
T |
|
| Q |
101 |
acaagctgttgaaagtagaaacgagcggtgggttcggagaatcttccacggcgggagagagcggagaaaagctcaccaccggcggcgaattcaacaataa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34017406 |
acaagctgttgaaagtagaaacgagcggtggattcggagaatcttccacggcgggagagagcggagaaaagctcaccaccggcggcgaattcaacgataa |
34017505 |
T |
|
| Q |
201 |
gatggattttggtttttgtagccatgacttcatggattttgaggatgttagggtggtgttggagacggcgc |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34017506 |
gatggattttggtttttgtagccatgacttcatggattttgaggatgttagggtggtgttggagacggcgc |
34017576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 15171856 - 15171972
Alignment:
| Q |
1 |
atcggaaaccttgagattcccatcggcgtcgaggaggagattctgcggtttaagatcacggtgagcgacgccattacggtggcagaaacgtaacgcagag |
100 |
Q |
| |
|
|||||||||||||||||| || || || ||||||||||||||||||||||| ||||| |||||||||| || |||||||||||||||| | || || |
|
|
| T |
15171856 |
atcggaaaccttgagattaccttcagcatcgaggaggagattctgcggtttgagatcgcggtgagcgataccgttacggtggcagaaacaaagagcggaa |
15171955 |
T |
|
| Q |
101 |
acaagctgttgaaagta |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
15171956 |
acaagctgttgaaagta |
15171972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University