View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21079_high_7 (Length: 231)
Name: NF21079_high_7
Description: NF21079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21079_high_7 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 85 - 214
Target Start/End: Complemental strand, 6359020 - 6358891
Alignment:
| Q |
85 |
gcaggtacaagttatagtcagaaatgttaaatgatattgttactagaagaaggattagaagcttcttttgaaagtgattttattccggttgaaatttgct |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6359020 |
gcaggtacaagttatagtcagaaatgttaaatgatattgttactagaagaaggattagaagcttcttttgaaagtgattttattccggttgaaatttgct |
6358921 |
T |
|
| Q |
185 |
ttatctgttccttgtacctaactaacccac |
214 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |
|
|
| T |
6358920 |
ttatctattccttgtacctaactaacccac |
6358891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 51
Target Start/End: Original strand, 6358072 - 6358122
Alignment:
| Q |
1 |
ttccaacagaaatcttaacacctcgacgttgcagaacatatttagttggaa |
51 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6358072 |
ttccaacagaaatcttaacacctcgacgttgcagaacatatttagttggaa |
6358122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 91 - 214
Target Start/End: Original strand, 32857478 - 32857601
Alignment:
| Q |
91 |
acaagttatagtcagaaatgttaaatgatattgttactagaagaaggattagaagcttcttttgaaagtgattttattccggttgaaatttgctttatct |
190 |
Q |
| |
|
||||||| ||||||||||||||||| |||| || | | |||||||| ||||||||||||| | | || |||||||| | |||| |||||||||||||| |
|
|
| T |
32857478 |
acaagttctagtcagaaatgttaaaggatactgccattggaagaaggcttagaagcttcttctaatagaaattttatttcagttgcaatttgctttatct |
32857577 |
T |
|
| Q |
191 |
gttccttgtacctaactaacccac |
214 |
Q |
| |
|
|||||||| ||||||||||||| |
|
|
| T |
32857578 |
cttccttgtctctaactaacccac |
32857601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University