View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21079_low_10 (Length: 290)
Name: NF21079_low_10
Description: NF21079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21079_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 24563190 - 24562939
Alignment:
| Q |
1 |
gtatgaagctcacctttgggataacagctgtagacgggaaggacagtcgagaaaaggccgccaaggtaaacttaaaacatcgaattaataattcttaggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24563190 |
gtatgaagctcacctttgggataacagctgtagaagggaaggtcagtcgagaaaaggccgccaaggtaaacttaaaacatcgaattaataactcttaggc |
24563091 |
T |
 |
| Q |
101 |
atggttttaaattacagtcgcaattacgctgcaaataattatattgcatttaaatacgactgagtcgaattttttggtgaaatgttgttgcagagacatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||| ||||| |||||||||| |||||||||||||||| |
|
|
| T |
24563090 |
atggttttaaattacagtcgcaattatgctgcaaataattatattgcatttaaatacgaccgagtcaaatttgttggtgaaatcttgttgcagagacatc |
24562991 |
T |
 |
| Q |
201 |
aaaatcttttatactgcagttgcataccgcaatttaaaacatgcttttaggg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24562990 |
aaaatcttttatactgcagttgcataccgcaatttaaaacatgcttttaggg |
24562939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 210 - 240
Target Start/End: Original strand, 31399196 - 31399226
Alignment:
| Q |
210 |
tatactgcagttgcataccgcaatttaaaac |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31399196 |
tatactgcagttgcataccgcaatttaaaac |
31399226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 41965297 - 41965229
Alignment:
| Q |
1 |
gtatgaagctcacctttgggataacagctgtagacgggaaggacagtcgagaaaaggccgccaaggtaa |
69 |
Q |
| |
|
|||||||||||||||||||||||| | |||||| ||||||| ||||| |||||||| || |||||||| |
|
|
| T |
41965297 |
gtatgaagctcacctttgggataatacttgtagaagggaaggtcagtcaagaaaaggacgtcaaggtaa |
41965229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University