View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21079_low_6 (Length: 351)
Name: NF21079_low_6
Description: NF21079
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21079_low_6 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 323; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 1 - 351
Target Start/End: Original strand, 42062754 - 42063104
Alignment:
| Q |
1 |
tcatcataccaatctgatcagctaagtaatgaacgtaactcagccttccgctggaagcatcccaactgaaatgaatacgaaggatgagggggagggtgag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42062754 |
tcatcataccaatctgatcagctaagtaatgaacgtaactcagccttccgctggaagcatcccaactgaaatgaatacgaaagatgagggggagggtgag |
42062853 |
T |
 |
| Q |
101 |
ttacttcacattaatgggaaacctatcaagggaaattttagactttgaaccaaaagaacttcgcattgcactctttcttcactttatcctcttattgctg |
200 |
Q |
| |
|
|| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
42062854 |
ttgcttcacaataatgggaaacctatcaagggaaattttagactttgaaccaaaagaactttgccttgcactctttcttcactttatcctcttattgcta |
42062953 |
T |
 |
| Q |
201 |
caaagatccctctccagtgtcaactatcactgagatatggagaatcagtactagttatgtgatccattacacaaactcattattgccaaaataaacacga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42062954 |
caaagatccctctccagtgtcaactatcactgagatatggagaatcagtactagttatgtgatccattacacaaactcattattgccaaaataaacacga |
42063053 |
T |
 |
| Q |
301 |
gcacaacacatagattaactggcttagctttaggatctacagctttgacgc |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42063054 |
gcacaacacatagattaactggcttagcttcaggatctacagctttgacgc |
42063104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University