View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2107_high_7 (Length: 248)
Name: NF2107_high_7
Description: NF2107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2107_high_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 58 - 224
Target Start/End: Complemental strand, 1638277 - 1638112
Alignment:
| Q |
58 |
tgaaatgtttatatgagattttgtattaattatactttggcannnnnnnnaataggccaatgttactatattaacctttacgttaacannnnnnncctcc |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
1638277 |
tgaaatgtttatatgagattttgtattaattatactttggcattttttttaataggc-aatgttaccatattaacctttacgttaacatttttttcctcc |
1638179 |
T |
 |
| Q |
158 |
ttcttttattgttttccaaagtatatcaaatgtaaagttaaaaaatcaacttttaaactaggagaat |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1638178 |
ttcttttattgttttccaaagtatatcaaatgtaaagttaaaaaataaacttttaaactaggagaat |
1638112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 16 - 61
Target Start/End: Complemental strand, 1638348 - 1638303
Alignment:
| Q |
16 |
attgaattcattgaacttgatgtgcttgataaaattaattagtgaa |
61 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1638348 |
attgaattcattgaacttgatgtgcttaataaaattaattagtgaa |
1638303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University