View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2107_low_7 (Length: 306)
Name: NF2107_low_7
Description: NF2107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2107_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 77; Significance: 9e-36; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 19 - 95
Target Start/End: Complemental strand, 44993569 - 44993493
Alignment:
| Q |
19 |
gggatgcattccatgcacaatttcagcagaatgaatttccactcttgtgctttcaacaactcttaacaaacacttgc |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44993569 |
gggatgcattccatgcacaatttcagcagaatgaatttccactcttgtgctttcaacaactcttaacaaacacttgc |
44993493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 224 - 295
Target Start/End: Complemental strand, 44993379 - 44993308
Alignment:
| Q |
224 |
ttaaagaaaaagtgagactgttgtcttaagttaatctgttcctgattcttatccttcaaatttttagcctat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44993379 |
ttaaagaaaaagtgagactgttgtcttaagttaatctgttcctgattcttatccttcaaattttttgcctat |
44993308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 58 - 95
Target Start/End: Complemental strand, 44981706 - 44981669
Alignment:
| Q |
58 |
cactcttgtgctttcaacaactcttaacaaacacttgc |
95 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
44981706 |
cactcttatgctttcaacaattcttaacaaacacttgc |
44981669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University