View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21080_high_15 (Length: 336)
Name: NF21080_high_15
Description: NF21080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21080_high_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 20 - 330
Target Start/End: Complemental strand, 27758487 - 27758177
Alignment:
| Q |
20 |
ggcattaggttctagacgtgcagcaatatcaccatcctagataaacaagagcttcaaatgttttggatgaaccgatacctcgattattttctttttcaac |
119 |
Q |
| |
|
|||||| ||||||||||| | | |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27758487 |
ggcattgggttctagacgcgaaacaatatcaccatcctaaataaacaagagcttcaaatgttttggatgaaccgatacctcgattattttctttttcaac |
27758388 |
T |
|
| Q |
120 |
ccatttatgaacatttggcttggtactatgttctaatgcaatgatattttaccatgctcaactctatttgtaacattgtgaggatgcagctaatgacatg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27758387 |
ccatttatgaacatttggcttggtactatgttctgatgcaatgatattttaccatgatcaactctatttgtaacattgtgaggatgcagctaatgacatg |
27758288 |
T |
|
| Q |
220 |
ctaaaacatcgtggcctatgctcttgcaatgagagcaaatgttcggtaactattcgtaaacaacctctttgttaatgtgtatgtttacttttctttactt |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||||||||||| |
|
|
| T |
27758287 |
ctaaaacatcgtggcctatgctcttgcaatgagagcaaatgttcggtaactattcgtaaacaacctctttgctaatttgtatgttttcttttctttactt |
27758188 |
T |
|
| Q |
320 |
tttgatgatgt |
330 |
Q |
| |
|
||||||||||| |
|
|
| T |
27758187 |
tttgatgatgt |
27758177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University