View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21080_high_20 (Length: 239)

Name: NF21080_high_20
Description: NF21080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21080_high_20
NF21080_high_20
[»] chr4 (1 HSPs)
chr4 (19-239)||(27631100-27631320)
[»] chr3 (1 HSPs)
chr3 (23-67)||(55190785-55190829)


Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 27631100 - 27631320
Alignment:
19 gagctatggccttatgttccatacgatgttgttgcacacccttatgcacctggtgtttatgacaaaaaagcaccatctggttacgttagaaacgcaaatt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27631100 gagctatggccttatgttccatacgatgttgttgcacacccttatgcacctggtgtttatgacaaaaaagcaccatctggttacgttagaaacgcaaatt 27631199  T
119 atgatccaaatgtttcaaatcttgctcgtgctagttcagctgaagttagatacactactgctttcagtgatgataaccccactgcatgtgccattatgtg 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27631200 atgatccaaatgtttcaaatcttgctcgtgctagttcagctgaagttagatacactactgctttcagtgatgataaccccactgcatgtgccattatgtg 27631299  T
219 attcgacatagaccaccacct 239  Q
    |||||||||||||||||||||    
27631300 attcgacatagaccaccacct 27631320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 67
Target Start/End: Complemental strand, 55190829 - 55190785
Alignment:
23 tatggccttatgttccatacgatgttgttgcacacccttatgcac 67  Q
    ||||||| |||||||||||||| || ||||||||||| |||||||    
55190829 tatggccatatgttccatacgacgtcgttgcacacccatatgcac 55190785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University