View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21080_high_22 (Length: 208)

Name: NF21080_high_22
Description: NF21080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21080_high_22
NF21080_high_22
[»] chr4 (2 HSPs)
chr4 (1-132)||(27631621-27631752)
chr4 (168-196)||(27631787-27631815)


Alignment Details
Target: chr4 (Bit Score: 116; Significance: 3e-59; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 27631621 - 27631752
Alignment:
1 ctttctccaagccttaatgcttttgaattataaaaaataaagataagttttccgatcgtttgattgtgatcgagtgatcgtcgatgtcctaaatatgtga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||    
27631621 ctttctccaagccttaatgcttttgaattataaaaaataaagataagttttccgaccgtttgattgtgatcgaatgatcatcgatgtcctaaatatgtga 27631720  T
101 atgtatgatccaacgaatgtagggaatcgtcg 132  Q
    |||| |||||||||||||||||||||||||||    
27631721 atgtgtgatccaacgaatgtagggaatcgtcg 27631752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 196
Target Start/End: Original strand, 27631787 - 27631815
Alignment:
168 gcattagcttgtcaatattatatgagtat 196  Q
    |||||||||||||||||||||||||||||    
27631787 gcattagcttgtcaatattatatgagtat 27631815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University