View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21080_low_14 (Length: 347)
Name: NF21080_low_14
Description: NF21080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21080_low_14 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 323; Significance: 0; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 1 - 347
Target Start/End: Complemental strand, 12123131 - 12122785
Alignment:
| Q |
1 |
actaaattgaagggagagttattgtttatggacttgagtgctggtttgttcattggttttcatttatacgtaagcatgccacatactaagaacttgctgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
12123131 |
actaaattgaagggagagttattgtttatggacttgagtgatggtttgttcattggttttcatttatacgtaagcatgccacatactaagaacttgatag |
12123032 |
T |
|
| Q |
101 |
tcgtggtaaggattttgttgctggcttaggtacctaaaatcttaaatgcagttcaattatgctctctatcagaatgtgttaatacttaatattcatattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12123031 |
tcgtggtaaggattttgttgctggcttaggtacctaaaatcttaaatgcagttcaattatgctctctatcagaatgtgttaatacttaatattcatattt |
12122932 |
T |
|
| Q |
201 |
gtacatagacaaagttttgcaaaatactactatttgtacctacatattgttcagttcaatctatgtccctctagttcggtgttattggttttatggattc |
300 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12122931 |
gcacatagacaaagttttgcaaaatactactatttgtacctacatattgttcagttcaatctatgtctctctagttcggtgttattggttttatggattc |
12122832 |
T |
|
| Q |
301 |
tgtctaaagtaatcttcattatgtccctctattttgatagtctgtcc |
347 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12122831 |
tgtctaaagtaatcttcattatgtctctctattttgatagtctgtcc |
12122785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 79
Target Start/End: Complemental strand, 14692311 - 14692250
Alignment:
| Q |
18 |
gttattgtttatggacttgagtgctggtttgttcattggttttcatttatacgtaagcatgc |
79 |
Q |
| |
|
||||||||||||||||||| ||| | |||| ||||||| ||||||||| |||||| |||||| |
|
|
| T |
14692311 |
gttattgtttatggacttgggtgatcgtttattcattgattttcatttctacgtatgcatgc |
14692250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University