View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21080_low_22 (Length: 239)
Name: NF21080_low_22
Description: NF21080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21080_low_22 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 19 - 239
Target Start/End: Original strand, 27631100 - 27631320
Alignment:
| Q |
19 |
gagctatggccttatgttccatacgatgttgttgcacacccttatgcacctggtgtttatgacaaaaaagcaccatctggttacgttagaaacgcaaatt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27631100 |
gagctatggccttatgttccatacgatgttgttgcacacccttatgcacctggtgtttatgacaaaaaagcaccatctggttacgttagaaacgcaaatt |
27631199 |
T |
|
| Q |
119 |
atgatccaaatgtttcaaatcttgctcgtgctagttcagctgaagttagatacactactgctttcagtgatgataaccccactgcatgtgccattatgtg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27631200 |
atgatccaaatgtttcaaatcttgctcgtgctagttcagctgaagttagatacactactgctttcagtgatgataaccccactgcatgtgccattatgtg |
27631299 |
T |
|
| Q |
219 |
attcgacatagaccaccacct |
239 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
27631300 |
attcgacatagaccaccacct |
27631320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 67
Target Start/End: Complemental strand, 55190829 - 55190785
Alignment:
| Q |
23 |
tatggccttatgttccatacgatgttgttgcacacccttatgcac |
67 |
Q |
| |
|
||||||| |||||||||||||| || ||||||||||| ||||||| |
|
|
| T |
55190829 |
tatggccatatgttccatacgacgtcgttgcacacccatatgcac |
55190785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University