View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21080_low_24 (Length: 208)
Name: NF21080_low_24
Description: NF21080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21080_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 3e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 27631621 - 27631752
Alignment:
| Q |
1 |
ctttctccaagccttaatgcttttgaattataaaaaataaagataagttttccgatcgtttgattgtgatcgagtgatcgtcgatgtcctaaatatgtga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
27631621 |
ctttctccaagccttaatgcttttgaattataaaaaataaagataagttttccgaccgtttgattgtgatcgaatgatcatcgatgtcctaaatatgtga |
27631720 |
T |
|
| Q |
101 |
atgtatgatccaacgaatgtagggaatcgtcg |
132 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |
|
|
| T |
27631721 |
atgtgtgatccaacgaatgtagggaatcgtcg |
27631752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 196
Target Start/End: Original strand, 27631787 - 27631815
Alignment:
| Q |
168 |
gcattagcttgtcaatattatatgagtat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27631787 |
gcattagcttgtcaatattatatgagtat |
27631815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University