View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21080_low_27 (Length: 202)

Name: NF21080_low_27
Description: NF21080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21080_low_27
NF21080_low_27
[»] chr4 (1 HSPs)
chr4 (1-187)||(55076275-55076461)
[»] chr6 (1 HSPs)
chr6 (4-179)||(15125600-15125775)


Alignment Details
Target: chr4 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 55076275 - 55076461
Alignment:
1 tttgggtgggccctacagctctcccttctcacaccatacattcagcttctaggtgtacctcacaagtgggctgccaacatctggctatgtggtcccatat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55076275 tttgggtgggccctacagctctcccttctcacaccatacattcagcttctaggtgtacctcacaagtgggctgccaacatctggctatgtggtcccatat 55076374  T
101 caggcatgatcgtccagccaatcgttggctactacagtgaccgaagtcattctcgttttggtcgccgccgccctttcatcttctctg 187  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55076375 caggcatgatcgtccagccaatcgttggatactacagtgaccgaagtcattctcgttttggtcgccgccgccctttcatcttctctg 55076461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 4 - 179
Target Start/End: Complemental strand, 15125775 - 15125600
Alignment:
4 gggtgggccctacagctctcccttctcacaccatacattcagcttctaggtgtacctcacaagtgggctgccaacatctggctatgtggtcccatatcag 103  Q
    ||||||||||||||||| ||  | || ||||||||  | ||| | || ||||| || ||  ||||||||||||||||||||||||||||||| || ||||    
15125775 gggtgggccctacagctttcattgctaacaccatatgtccagttgcttggtgtcccacatcagtgggctgccaacatctggctatgtggtccaatttcag 15125676  T
104 gcatgatcgtccagccaatcgttggctactacagtgaccgaagtcattctcgttttggtcgccgccgccctttcat 179  Q
    | |||||| | || ||| | || |||||||||||||||||||| ||||| ||||| || || || |||||||||||    
15125675 gtatgatcatacaaccacttgtaggctactacagtgaccgaagccattcacgtttcggacgtcgtcgccctttcat 15125600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University