View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21080_low_27 (Length: 202)
Name: NF21080_low_27
Description: NF21080
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21080_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 3e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 3e-99
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 55076275 - 55076461
Alignment:
| Q |
1 |
tttgggtgggccctacagctctcccttctcacaccatacattcagcttctaggtgtacctcacaagtgggctgccaacatctggctatgtggtcccatat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076275 |
tttgggtgggccctacagctctcccttctcacaccatacattcagcttctaggtgtacctcacaagtgggctgccaacatctggctatgtggtcccatat |
55076374 |
T |
 |
| Q |
101 |
caggcatgatcgtccagccaatcgttggctactacagtgaccgaagtcattctcgttttggtcgccgccgccctttcatcttctctg |
187 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55076375 |
caggcatgatcgtccagccaatcgttggatactacagtgaccgaagtcattctcgttttggtcgccgccgccctttcatcttctctg |
55076461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 4 - 179
Target Start/End: Complemental strand, 15125775 - 15125600
Alignment:
| Q |
4 |
gggtgggccctacagctctcccttctcacaccatacattcagcttctaggtgtacctcacaagtgggctgccaacatctggctatgtggtcccatatcag |
103 |
Q |
| |
|
||||||||||||||||| || | || |||||||| | ||| | || ||||| || || ||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
15125775 |
gggtgggccctacagctttcattgctaacaccatatgtccagttgcttggtgtcccacatcagtgggctgccaacatctggctatgtggtccaatttcag |
15125676 |
T |
 |
| Q |
104 |
gcatgatcgtccagccaatcgttggctactacagtgaccgaagtcattctcgttttggtcgccgccgccctttcat |
179 |
Q |
| |
|
| |||||| | || ||| | || |||||||||||||||||||| ||||| ||||| || || || ||||||||||| |
|
|
| T |
15125675 |
gtatgatcatacaaccacttgtaggctactacagtgaccgaagccattcacgtttcggacgtcgtcgccctttcat |
15125600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University