View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21081_high_22 (Length: 242)
Name: NF21081_high_22
Description: NF21081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21081_high_22 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 124 - 242
Target Start/End: Original strand, 386270 - 386388
Alignment:
| Q |
124 |
tagtatgcaagaatgaaaaatatatcttgtaaatgagtttcatacgtgttctttcaacatttctagttagagcattatctcgttgaaagtcaaaatgtat |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
386270 |
tagtatgcaagaatgaaaaatatatcttgtaaatgagtttcatacgtgttctttcaacatttctagttagagcattatctcgttgaaagtcaaaatgtat |
386369 |
T |
|
| Q |
224 |
caaagaagccacaaattat |
242 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
386370 |
caaagaagccacaaattat |
386388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 18 - 128
Target Start/End: Original strand, 386150 - 386245
Alignment:
| Q |
18 |
aataaaggtagtgggatcataatattgcccttctggtgagtttttagttgacaggtttacatgtatgtaacttacaaatcgatgaaacatgtgggttgtt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
386150 |
aataaaggtagtgggatcataatattgcccttctggtgagtttttagttgacaggtttac---------------aaatcgatgaaacatgtgggttgtt |
386234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University