View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21081_low_14 (Length: 288)
Name: NF21081_low_14
Description: NF21081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21081_low_14 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 233 - 288
Target Start/End: Original strand, 43213241 - 43213296
Alignment:
| Q |
233 |
aaatttttcaaggagggtttggtggatatgaatctatgttatttagagagattaat |
288 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43213241 |
aaatttttgaaggaggatttggtggatatgaatctatgttatttagagagattaat |
43213296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University