View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21081_low_20 (Length: 250)
Name: NF21081_low_20
Description: NF21081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21081_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 6227159 - 6226913
Alignment:
| Q |
1 |
actggatgataaacagtatgacaacaacgtgttggacaaggtaatggaaactcaagctcattgccgaaacctgtagatagata----------------t |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | |
|
|
| T |
6227159 |
actggatgataaacagtatgacaacaacgtgttggacaaggtaatggaaactcaagctcattgccgaaacctgtagatatatagatacagatcattagat |
6227060 |
T |
 |
| Q |
85 |
tgattgacatgaaaattgtgattgcaaaatagtgaaaacttatatggggagataactaatagaaaaaacggaaaagcgaaatccttactgtcatgtgcaa |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6227059 |
tgattgacatgaaaattgtgattgcaaaatagtgaaaacttatatggg-agataactaatagaaaaaacggaaaagcgaaatccttactgtcatgtgcaa |
6226961 |
T |
 |
| Q |
185 |
accaccatgagggatcgcgaacagaggagatcgtagtgccgacgtctc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6226960 |
accaccatgagggatcgcgaacagaggagatcgtagtgccgacgtctc |
6226913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University