View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21081_low_21 (Length: 246)
Name: NF21081_low_21
Description: NF21081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21081_low_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 9 - 232
Target Start/End: Complemental strand, 34865584 - 34865361
Alignment:
| Q |
9 |
agcagagactggtgacggagacttgaagaaaaagtgtgtgatgatggatgatgacgcagttgactggctaaatcttcctcgagaattatggttagttatt |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34865584 |
agcagggactggtgacggagacttgaagaaaaagtgtgtgatgatggatgatgacgcagttgactggctaaatcttcctcgagaattatggttagttatt |
34865485 |
T |
|
| Q |
109 |
atatccatgaatttgaatccatttgatgttcttcgattccgtagtgtctgtgctttattgcgctctattcttccccctcctttttcttctccttctcaca |
208 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| | |
|
|
| T |
34865484 |
atatccaagaatttgaatccatttgatgttcttcgattccgtagtgtctgtgctttattgcgctctattcttccccctccttttccttctccttctcata |
34865385 |
T |
|
| Q |
209 |
cacttcgcattccagatggtaagt |
232 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
34865384 |
cacttcgcattccagatggtaagt |
34865361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 64; Significance: 4e-28; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 24 - 115
Target Start/End: Original strand, 51857986 - 51858077
Alignment:
| Q |
24 |
cggagacttgaagaaaaagtgtgtgatgatggatgatgacgcagttgactggctaaatcttcctcgagaattatggttagttattatatcca |
115 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||||| | ||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51857986 |
cggagacttgaagaaagtgtgtgtgatgatagatgatgacacggttgattggctaaatcttcctcgagacttatggttagttattatatcca |
51858077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 140 - 192
Target Start/End: Original strand, 51858087 - 51858139
Alignment:
| Q |
140 |
ttcgattccgtagtgtctgtgctttattgcgctctattcttccccctcctttt |
192 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
51858087 |
ttcgattccgtagtgcctgtgctttatggcgctctattctttcccctcctttt |
51858139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 130 - 222
Target Start/End: Complemental strand, 9518636 - 9518544
Alignment:
| Q |
130 |
tttgatgttcttcgattccgtagtgtctgtgctttattgcgctctattcttccccctcctttttcttctccttctcacacacttcgcattcca |
222 |
Q |
| |
|
||||||||| || |||| || |||| ||| |||| | |||||||||| |||||||||||||| | ||| | |||||||||||||| |||||| |
|
|
| T |
9518636 |
tttgatgttattagatttcgaggtgtttgtcctttgtggcgctctattattccccctccttttccatcttcctctcacacacttcgtattcca |
9518544 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University