View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21081_low_25 (Length: 207)
Name: NF21081_low_25
Description: NF21081
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21081_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 19 - 176
Target Start/End: Complemental strand, 13376292 - 13376135
Alignment:
| Q |
19 |
aggatgtttatgtttacttctcctaaaagataaccttggaccctgaacctctaactcttgtgaactttttctcttcttgctgacccatcttctactatgt |
118 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13376292 |
aggatgtttatatttacttctcctaaaagatacccttggactctgaatctctaactcttgtgaactttttctcttcttgctgacccatcttctactatgt |
13376193 |
T |
 |
| Q |
119 |
ggcattatgcattgttgagaaacaattggtcttcgttgttcgctttgatgtggtagaa |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
13376192 |
ggcattatgcattgttgagaaacaattggtcttcgttgttcactttgatgtggtagaa |
13376135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University